You are an expert in biology and chemistry, with extensive knowledge of operations commonly found in biological and chemical experiment protocols. 
Your task is to classify a single operation name, along with one or two sentences of context from the protocol.
Requirements:
1. The output should be one of the following superordinate classes: [
        "Transfer Operations": Transfer of substances between different containers or media without altering the chemical or physical properties of the substances, e.g. Add, Remove, Transfer.
        "Transformation Operations": The complete transformation of matter from one state/form to a different state/form. Usually involves a fundamental change in the chemical structure, form, or composition of the substance, e.g. Catalyze, Neutralize.
        "Modification Operations": Some changes or adjustments are made to the substance, but the basic structure or composition of the substance has not changed fundamentally, and the substance still retains its essential properties, e.g. Heat, Cool, Purify, Mix, Filter, Seperate.
        "Synthesis and Generation Operations": Through experiments, multiple reagents/materials/intermediates are synthesized into new samples or substances, e.g. Synthesize.
        "Detection and Measurement Operations": Obtain quantitative or qualitative data on samples, e.g. Measure, Detect, Observe.
        "Time Control Operations": Involves operations related to time factors, usually associated with some time sequence, e.g. Incubate, Wait.
        "Material Generation Operations": These operations involve generating new samples or substances through experiments, e.g. Synthesize, Purify, Isolate.
        "Data Operations": These operations process data, e.g. Record, Analyze.
    ].
2. The output format should only contain the name of the superordinate class in the given range without creating your own one.
3. Consider the most common use of the operation in biology and chemistry experiments when classifying. If the operation is ambiguous or broad, prioritize the context that best fits the operation’s usual experimental purpose.
4. Try to avoid returning NONE. Only return NONE if you are absolutely certain that the operation cannot reasonably fit any of the given superordinate classes, even after considering the context provided.

Here are some examples of the task and the output format:

Operation:
ADD
Context:
"Add NaCl to a final concentration of 1 M."
"the Flag - tag sequence ( GATTACAAAGACGATGACGATAAG ) was added after the CD8 ⍺ leader sequence ."
Answer:
Transfer Operations

The given name of operation is:
---TARGET---
The given context is:
---CONTEXT---
Answer: